View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12590_low_43 (Length: 239)
Name: NF12590_low_43
Description: NF12590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12590_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 31265416 - 31265194
Alignment:
| Q |
1 |
aattcgtgcagggacatattggggaattcagaagatgcgtgtgattatagacgggtttaagatttttattctgcaattatgttaagctgctcattgttat |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31265416 |
aattcgtgtggggacatattggggaattcagaagatgcgtgtgattatagacgggtttaagatttttattctgcaattatgttaagctgctcattgttat |
31265317 |
T |
 |
| Q |
101 |
ttgttttcactgtttttgttacagcaaccatgaaccctctgatgatgaagatgaagtgagtaaaacacttaaccttttcattagctattagtggaactca |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31265316 |
ttgttttcactgtttttgttacagccaccatgaaccctctgatgatgaagatgaagtgagtaaaacacttacccttttcattagctattagtggaactca |
31265217 |
T |
 |
| Q |
201 |
ttgaatgcattgatctaactttc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31265216 |
ttgaatgcattgatctaactttc |
31265194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University