View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12590_low_45 (Length: 236)
Name: NF12590_low_45
Description: NF12590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12590_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 6 - 220
Target Start/End: Original strand, 42701586 - 42701800
Alignment:
| Q |
6 |
gagaagcaaaggacagaaagactaacgttaaaaaatttgaaacttgtgactcgtgagctgtgagacatagcagcagcacacaacactgatattgtcacat |
105 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42701586 |
gagaaccaaaagacagaaagactaacgttaaaaaatttgaaacttgtgactcgtgagctgtgagacatagcagcagcacacaacactgatattggcacat |
42701685 |
T |
 |
| Q |
106 |
aaacattagtagtgattttaaaaggaaaaaagtgataggttataaccagcaagtgtttgtgttgtatgtatatcaggcagcgtagagtgtcgaacatgtc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
42701686 |
aaacattagtagtgattttaaaaggaaaaaagtgataggttataaccagcaagtgtttgtgtcgtgtgtatatcaggcagcgtagagtgtcgaacatgtc |
42701785 |
T |
 |
| Q |
206 |
ttttacctaaattct |
220 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42701786 |
ttttacctaaattct |
42701800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University