View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12590_low_46 (Length: 235)
Name: NF12590_low_46
Description: NF12590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12590_low_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 26 - 220
Target Start/End: Original strand, 9413476 - 9413670
Alignment:
| Q |
26 |
agaacgaagatccaaactctccttagattgagtattagcactagtcatatcatgcatttgaggtgtagaaccagacatagcaccatcttgccaaagatga |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9413476 |
agaacgaagatccaaactctccttagattgagtattagcactagtcatatcatgcatttgaggtgtagaaccagacatagcaccatcttgccaaagatga |
9413575 |
T |
|
| Q |
126 |
accaaagaagtagttccaacaggaagagtaatacttgcataaatcgtaacctcgttattttcatgtgtagcactcaaccttgaatgaggataact |
220 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
9413576 |
accaaagaaggagttccaacaggaagagtaatacttgcataaatcgtaacctcgttattttcatgtgtagcaatcaaccctgaatgaggataact |
9413670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University