View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12590_low_47 (Length: 233)
Name: NF12590_low_47
Description: NF12590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12590_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 51111282 - 51111486
Alignment:
| Q |
18 |
aaaacaaagaaaaagattactactcccatatatgatgatatatatacacaca--agaaagatcttctcttctatagaagatgtcatcatgaaaagcttaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51111282 |
aaaacaaagaaaaagattactactcccatatatgatgatatatacacacacataagaaaggtcttctcttctatagaagatgtcatcatgagaagcttaa |
51111381 |
T |
 |
| Q |
116 |
agctcaggatctcggcgttgtccacccaatttttgctttgcagcttcatagtttgaggctatggtttccttggctgcatttgctatgttacttgctttct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51111382 |
agctcaggatctcggcgttgtccacccaatttttgctttgcagcttcatagtttgaggctatggtttccttggctgcatttgctatgttacttgctttct |
51111481 |
T |
 |
| Q |
216 |
ctgct |
220 |
Q |
| |
|
||||| |
|
|
| T |
51111482 |
ctgct |
51111486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University