View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12591_high_8 (Length: 278)
Name: NF12591_high_8
Description: NF12591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12591_high_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 8 - 229
Target Start/End: Complemental strand, 13729532 - 13729311
Alignment:
| Q |
8 |
gagcagagaaactaaacatccgaagacaacgactcgcccatctatcacttgtaatagtcatatgtggaacacatgcaagtccaactttaaattcataact |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13729532 |
gagcagagaaactaaacatccgaagacaacgactcgcccatctatcacttgtaatagtcatatgtggaacacatgcaagtccaactttaaattcataact |
13729433 |
T |
|
| Q |
108 |
aaaaatattggaatatgcatgacacggtggaaattagcttagatttaaaaagctcaaaaatctgtgttttacacaatgaaatctttatgacccaatcaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13729432 |
aaaaatattggaatatgcatgacacggtggaaattagcttagatttaaaaagctcaaaaatctgtgttttacacaatgaaatctttatgaccaaatcaaa |
13729333 |
T |
|
| Q |
208 |
atgaaatcttaagtataattta |
229 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
13729332 |
atgaaatcttaagtataattta |
13729311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 13728935 - 13728878
Alignment:
| Q |
221 |
tataatttaaaagttagaacaatttttggcattgaaatctcaagaataatttaaaatc |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13728935 |
tataatttaaaatttagaacaatttttggcattgaaatctcaagaataatttaaaatc |
13728878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 209 - 260
Target Start/End: Complemental strand, 13728903 - 13728852
Alignment:
| Q |
209 |
tgaaatcttaagtataatttaaaagttagaacaatttttggcattgaaatct |
260 |
Q |
| |
|
|||||||| ||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13728903 |
tgaaatctcaagaataatttaaaatctagaacaatttttggcattgaaatct |
13728852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University