View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12591_low_13 (Length: 296)
Name: NF12591_low_13
Description: NF12591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12591_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 133 - 280
Target Start/End: Complemental strand, 3081176 - 3081029
Alignment:
| Q |
133 |
ttgtaggaaacactctagtttttcttctgataaccaaaaacatgtaataattgagattaaaaattagccttaacttttcaccttatttattcagtggtct |
232 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3081176 |
ttgtaggaaacacactagtttttctactgataaccaaaaacatgtaataattgagattaaaaattagccgtaacttttcaccttatttattcagtggtct |
3081077 |
T |
|
| Q |
233 |
cataacaaaatgggatagtttttcttctcatttttaaaaacttttaca |
280 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3081076 |
cataacaaaatgagatagtttttcttctcatttttaaaaacttttaca |
3081029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University