View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12591_low_21 (Length: 221)
Name: NF12591_low_21
Description: NF12591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12591_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 40550623 - 40550418
Alignment:
| Q |
1 |
ccagaacaagtaatcaagcttgtgagtatatgttattatgattacatttttaatacctgctcaaaaccagttaagatttggtaccatatgcaacataaac |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40550623 |
ccagaacaagtactcaagcttgtgagtatatgttattatgattacatttttaatacctgctcaaaaccagttaagatttggtaccatatgcaacataagc |
40550524 |
T |
 |
| Q |
101 |
tcatgacttagtttaccttctctgtgcaggcagtggatttcaagaagcctgtctacaaggaagtccttgcatcgtttgctccacatctccaataatctca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40550523 |
tcatgacttagtttaccttctctgtgcaggcagtggatttcaagaagcctgtctacaaggaagtccttgcatcgtttgctccacatctccaataatctca |
40550424 |
T |
 |
| Q |
201 |
tctctg |
206 |
Q |
| |
|
|||||| |
|
|
| T |
40550423 |
tctctg |
40550418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University