View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12591_low_4 (Length: 485)
Name: NF12591_low_4
Description: NF12591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12591_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 385; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 385; E-Value: 0
Query Start/End: Original strand, 1 - 465
Target Start/End: Original strand, 3534472 - 3534919
Alignment:
| Q |
1 |
catgttacactacaatgtatgaagcataaacttgcagtgtttggaaagagatgtcaactatttggttatatttgatgtctccacaaaggtgaaaagttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3534472 |
catgttacactacaatgtatgaagcataaacttgcagtgtttggaaagagatgtcaactatttggttatatttgatgtctccacaaaggtgaaaagttac |
3534571 |
T |
|
| Q |
101 |
atgtagtagttaagccacaaaaagttgccatttccaaaatttgcttttcatattcactgagaatatcattactattggtatttatttctgaatgagtagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3534572 |
atgtagtagttaagccacaaaaagttgccatttccaaaatttgcttttcatattcactgagaatatcattactattggtatttatttctgaatgagtagt |
3534671 |
T |
|
| Q |
201 |
atcgatgtcaggcaatgtgccagaattatttgtgtgaa---tgttgtttctgaatttttcggtatttatgtggctgcaatttcgcagagatggtgactgg |
297 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3534672 |
attgatgtcaggcaatgtgccagaattatttgtgtgaatgttgttgtttctgaatttttcggtattt--------------------agatggtgactgg |
3534751 |
T |
|
| Q |
298 |
tgatatcatttagatggtgcttttaaatttacagcatgtttggttttgcgttcattccaactttttagcgtcccaatgcaatattgccctgtttttagaa |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3534752 |
tgatatcatttagatggtgcttttaaatttacagcatgtttggttttgcgttcattccaactttttagcgtcccaatgcaatattgccctgtttttagaa |
3534851 |
T |
|
| Q |
398 |
gatatgaagctataaaatgaagtttctatctcatggctcccatgcacatgcttaatcttgttactcct |
465 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3534852 |
gatatgaagctataaaatgaagtttctatctcatggctcccatgcacatgcttaatcttgttactcct |
3534919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University