View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12591_low_8 (Length: 341)
Name: NF12591_low_8
Description: NF12591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12591_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 1 - 328
Target Start/End: Complemental strand, 32575578 - 32575243
Alignment:
| Q |
1 |
attgattacaatagagcattcaaacctgcactaagaaatagtgatcttgacatttcaacgtctttccaagctaaaaatgcctttcggctgtttacatgct |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
32575578 |
attgattacaatagaacattcaaacctgcactaagaaatagcgatcttgacatttcaacgtctttccaagctaaaaatgccttccggttgtttacatgct |
32575479 |
T |
 |
| Q |
101 |
tcattcacaacacactattctttttaagctagttttggatccaaatttaatatcctttttacgacccgatttgtg---------ggnnnnnnnnnaccgt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| | |
|
|
| T |
32575478 |
tcattcacaacacactattctttttaagctagttttggatccaaatttaatatcctttttacgacctgatttgtgttttttttttttttttttttaccct |
32575379 |
T |
 |
| Q |
192 |
aataacctttctcacccttgtggacttaaccactatttctttttggcccaactccacaacacgctcccatgcttctggaacccgatccacttcatggttt |
291 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32575378 |
aataacctttctcacccttctggacttaaccactatttctttttggcccaactccacaacatgctcccatgcttatggaacccgatccacttcatggttt |
32575279 |
T |
 |
| Q |
292 |
gannnnnnnatgtggaaaagacttagtttttggttga |
328 |
Q |
| |
|
| |||||||||||||||||||| ||||||| |
|
|
| T |
32575278 |
-aattttttatgtggaaaagacttagtttctggttga |
32575243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University