View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12592_high_1 (Length: 326)
Name: NF12592_high_1
Description: NF12592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12592_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 18 - 313
Target Start/End: Complemental strand, 40183167 - 40182872
Alignment:
| Q |
18 |
aatatgaccctgcccatggtgttgaaatatttccaactacacttccaacattaactatggttccacnnnnnnncagagccatgtgaggcacaacttgttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40183167 |
aatatgaccctgcccatggtgttgaaatattcccaactacacttccaacattaactatggttccactttttttcagagccatgtgaggcacaacttgttg |
40183068 |
T |
 |
| Q |
118 |
caccattcttagttgtcccaacgtgttaatttccaatgtttttctaatagtgtctagtggtaattcggctaatggacccgtgctacctattccggcgtta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40183067 |
caccattcttagttgtcccaacgtgttaatttccaatgtttttctaatagtgtctagtggtaattcggctaatggacctgtgctacctattccggcgtta |
40182968 |
T |
 |
| Q |
218 |
ttaactagaatgtcgatacgtccgtattttgatataatagtgtccacggctgaagtagcgctttgatcagatgaaacgtcaagttcgagtgtctct |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40182967 |
ttaactagaatgtcgatacgtccgtattttgatataatagtgtccacggctgaagtagcgctttgatcagatgaaacgtcaagttcgagtgtctct |
40182872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University