View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12592_low_4 (Length: 260)
Name: NF12592_low_4
Description: NF12592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12592_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 63 - 246
Target Start/End: Complemental strand, 20513922 - 20513739
Alignment:
| Q |
63 |
ttgaactttcaaatactggtattttttgtttaatcttacaatacttaaatgtaggttcctcatatgtggaatttaaaaggtttgtttgattggttatttt |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20513922 |
ttgaactttcaaatactggtattttttgtttaatcttactatacttaaatgtaggttcctcatatgtggaatttgaaaggtttgtttgattggttatttt |
20513823 |
T |
 |
| Q |
163 |
gacaattttataattacatgtatgtttgactaggtagtacaagcacatacatatcaaccatatgtgttgataatattgtgatgt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20513822 |
gacaattttataattacatgtatgtttgactaggtagtataagcacatacatatcaaccatatgtgttgataatattgcgatgt |
20513739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University