View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12593_low_7 (Length: 340)
Name: NF12593_low_7
Description: NF12593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12593_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 17 - 329
Target Start/End: Original strand, 37681444 - 37681756
Alignment:
| Q |
17 |
cagagattattgaaatttacgaagaaagatgtaatggagttgatgaaaccagctctgctggtgaagattctaatgcagatgaggtaaattcacctgacct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37681444 |
cagagattattgaaatttacgaagaaagatgtaatggagttgatgaaaccagctctgctggtgaagattctaatgcagatgaggtaaattcacctgacct |
37681543 |
T |
|
| Q |
117 |
gtctgtcaactcagggttcagggatcaggtggatactccttgggaaatcaattcacaaatgaaaccatcaaattctgtgaccggcaaacatgagctagtt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37681544 |
gtctgtcaactcagggttcagggatcaggtggatactccttgggaaatcaattcacaaatgaaaccatcaaattctgtgaccggcaaacatgagctagtt |
37681643 |
T |
|
| Q |
217 |
tatgcatccgaggacgacttagttgttgcacgaagggctgaatcttatattattcaaaaggccactgctgatgctgttgcaactgcaactgtaaaatcac |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37681644 |
tatgcatccgaggacgacttagttgttgcacgaaggggtgaatcttatattattcaaaaggccactgctgatgctgttgcaactgcaactgtaaaatcac |
37681743 |
T |
|
| Q |
317 |
tttttccagtgaa |
329 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37681744 |
cttttccagtgaa |
37681756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University