View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12594_low_13 (Length: 317)
Name: NF12594_low_13
Description: NF12594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12594_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 8 - 302
Target Start/End: Complemental strand, 36414845 - 36414551
Alignment:
| Q |
8 |
gaagcagagaaaagtggatgaaaagaggagagaagcactgagtaagatattggatataaaaggtggttcttgtagtgttgattggggattctattatatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36414845 |
gaagcagagaaaagtggatgaaaagaggagagaagcactgagtaagatattggatataaaaggtagttcttgtagtgttgattggggattctattatatg |
36414746 |
T |
|
| Q |
108 |
ttgatgtatggattaaaattctgttatgttattttgattaaagggttgaataattttattatgatgttcagggagcattagagtgttttgtagaattcga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36414745 |
ttgatgtatggattaaaattctgttatgttattttgattaaagggttgaataattttattttgatgttcagggagcattagagtgttttgtagaattcga |
36414646 |
T |
|
| Q |
208 |
ccagttcatttgaccgaaaagagaagaaattctgaacctgtatcagctggatccgagagaattcgggttaagtttggaggaacaaggaaagattt |
302 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36414645 |
ccggttcatttgaccgaaaagagaagaaattctgaacctgtatcagctggatccgagagaattcgggttaagtttggaggaacaaggaaagattt |
36414551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University