View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12594_low_22 (Length: 244)
Name: NF12594_low_22
Description: NF12594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12594_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 36733704 - 36733485
Alignment:
| Q |
1 |
attccttattgtcttatttgcattattttgagcagtacnnnnnnnncttagcttttcttgcttatcttttaaattctattgaagttttacctatagtttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36733704 |
attccttattgtcttatttgcattattttgagcagtacttttttttcttagcttttcttgcttatcttttaaattatattgaagttttacctatagtttt |
36733605 |
T |
|
| Q |
101 |
ggttctttctttggacttctgagtggtaaatcttatgatgaccttcatatatacttgcaagattcttgaaacacgagagacatattcaagagtgtaaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36733604 |
ggttctttctttggacttctgagtggtaaatcttatgatgaccttcatatatacttgcaagattcttgaaacacgagagacatattcaagagtgtaaaca |
36733505 |
T |
|
| Q |
201 |
cttactgagtggagatatcc |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
36733504 |
cttactgagtggagatatcc |
36733485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University