View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12594_low_26 (Length: 212)
Name: NF12594_low_26
Description: NF12594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12594_low_26 |
 | |
|
| [»] scaffold0189 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0189 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 14 - 202
Target Start/End: Original strand, 32732 - 32921
Alignment:
| Q |
14 |
acatcatactaaatcttatcactaataatcctaaactacttaaacacatgtgaaggccccctgtaatattgctaccaatcaacaagaaaactaaaactaa |
113 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32732 |
acatcatactaaatcttatcactgataatcctaaactacttaaacacatgtgaaggccccctgtaatattgctaccaatcaacaagaaaactaaaactaa |
32831 |
T |
|
| Q |
114 |
ataaaattatctggtcatt-aaactcacagtttatagtgctgcctgtgtagactagatgctgagtttttatggtggctatctctgcttct |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32832 |
ataaaattatctggtcattaaaactcacagtttatagtgctgcctgtgtagactagatgctgagtttttatggtggctatctctgtttct |
32921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 15 - 202
Target Start/End: Complemental strand, 48880934 - 48880732
Alignment:
| Q |
15 |
catcatactaaatcttatcactaataatcctaaactacttaaacacatgtgaaggccccctgtaatattgctaccaatcaacaagaaaactaaaactaaa |
114 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||| ||| |||||||||||| | ||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
48880934 |
catcatacaaaatgttatcactaataatcctaaactacttataca--tgtgaaggccccttataatattgctatcaaccaacaagaaaactaaaactaaa |
48880837 |
T |
|
| Q |
115 |
taaaattatctggtcatt-aaactcacag----------------tttatagtgctgcctgtgtagactagatgctgagtttttatggtggctatctctg |
197 |
Q |
| |
|
|||||||| ||||||||| |||||||| | ||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48880836 |
taaaattacctggtcattaaaactcacggttcatacattcaattctttatagtgttgcctgtgtagactagatgccgagtttttatggtggctatctctg |
48880737 |
T |
|
| Q |
198 |
cttct |
202 |
Q |
| |
|
|||| |
|
|
| T |
48880736 |
tttct |
48880732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University