View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12595_high_46 (Length: 264)
Name: NF12595_high_46
Description: NF12595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12595_high_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 33456912 - 33456800
Alignment:
| Q |
1 |
agagagattacatgcctcgtcaagcatggttagaagtttgaccttccttctttgatgctcaatcctatcagcaggtgacaaaggtgaaacatcttttgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33456912 |
agagagattacatgcctcgtcaagcatggttagaagtttgaccttccttctttgatgctcaatcctatcagcaggtgacaaaggtgaaacatcttttgaa |
33456813 |
T |
 |
| Q |
101 |
gaagatgaagaag |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33456812 |
gaagatgaagaag |
33456800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 148 - 249
Target Start/End: Complemental strand, 33456765 - 33456664
Alignment:
| Q |
148 |
ttgatttgaattagggtttgataattgtctactaaatttattcttcttgaattgaccccttccaacactacaaaactcttccaacaattcttgagcagct |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33456765 |
ttgatttgaattagggtttgataattgtctactaaatttattcttcttgaattgaccccttccaacactgcaaaactcttccaacaattcttgagcagct |
33456666 |
T |
 |
| Q |
248 |
tt |
249 |
Q |
| |
|
|| |
|
|
| T |
33456665 |
tt |
33456664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 7066108 - 7066191
Alignment:
| Q |
1 |
agagagattacatgcctcgtcaagcatggttagaagtttgaccttccttctttgatgctcaatcctatcagcaggtgacaaagg |
84 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||| |||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
7066108 |
agagagattacatgcctcatcaagcatggaaagaagcttgaccttccttctttgatgttcaatcctatcagcagctgacaaagg |
7066191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University