View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12595_high_51 (Length: 250)
Name: NF12595_high_51
Description: NF12595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12595_high_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 12 - 231
Target Start/End: Complemental strand, 47138195 - 47137976
Alignment:
| Q |
12 |
acagatgcatggattaagtgaagctgaactttataataaaatgtgaatttgattgcacaaattataatcattgagggttgagaaaaatgggtgttgaatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47138195 |
acagatgcatggattaagtgaagctgaactttataataaaatgtgaatgtgattgcacaaattataatcattgagggttgagaaaaatgggtgttgaatc |
47138096 |
T |
 |
| Q |
112 |
acttcaaatgttaaccacttcggattatgcatccataatctctatgaacctatttgtggcattgctatgtgcttgtatagtaattggtcatcttcttgaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47138095 |
acttcaaatgttaaccacttcggattatgcatccataatctctatgaacctatttgtggcattgctatgtgcttgtatagtaattggtcatcttcttgaa |
47137996 |
T |
 |
| Q |
212 |
gagaatcgatgggtgaatga |
231 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
47137995 |
gagaatcgatgggtgaatga |
47137976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 152 - 231
Target Start/End: Original strand, 36488195 - 36488274
Alignment:
| Q |
152 |
tctatgaacctatttgtggcattgctatgtgcttgtatagtaattggtcatcttcttgaagagaatcgatgggtgaatga |
231 |
Q |
| |
|
||||||||| | ||||||||| | || ||||||||||| || ||||||||||||| || |||||||| ||| ||||||| |
|
|
| T |
36488195 |
tctatgaacttgtttgtggcacttctgtgtgcttgtattgtccttggtcatcttctcgaggagaatcgctggatgaatga |
36488274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University