View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12595_high_56 (Length: 241)
Name: NF12595_high_56
Description: NF12595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12595_high_56 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 41 - 241
Target Start/End: Original strand, 21533027 - 21533225
Alignment:
| Q |
41 |
atatgtattaatgtttttagtgcatagttgttaaatttaatctttcaacactatttctgttgcatattatcattttgacatataaaattagatttatcat |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| || |
|
|
| T |
21533027 |
atatgtattaatgtttttagtgcatagttgttaaatttaatctttcaacactatttctgttgcatattatcattgtgacata--aaattagatttataat |
21533124 |
T |
 |
| Q |
141 |
gttagccagttgtggtgattcaaattgttgtgtcagagttagtcctttcctgcattataagttgtctcttctcgaaacagatgctcttctatacgcacta |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21533125 |
gttagccagttgtggtgattcaaattgttgtgtcggagttagtactttcctgcattataagttgtctcttctcgaaacagatgctcttctatacgcacta |
21533224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 47 - 101
Target Start/End: Complemental strand, 31481447 - 31481393
Alignment:
| Q |
47 |
attaatgtttttagtgcatagttgttaaatttaatctttcaacactatttctgtt |
101 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||| ||||||| |||| |
|
|
| T |
31481447 |
attaatgtttttagtgcattgttattaaatttaatctttcaatactatttttgtt |
31481393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University