View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12595_high_64 (Length: 211)
Name: NF12595_high_64
Description: NF12595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12595_high_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 15 - 196
Target Start/End: Complemental strand, 2937960 - 2937779
Alignment:
| Q |
15 |
cagagattgttattgccaagtggaacaactatggatatctgtttgtgttagttttctcaacactcactaccaaatgagtgtcaaccaggccagagtcatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2937960 |
cagagattgttattgccaagtggaacaactatggatatctgtttgtgttagttttctcaacactcactaccaaatgagtgtcaaccaggccagagtcatt |
2937861 |
T |
 |
| Q |
115 |
tggttgcaaaaattctttatgtttcttgtatggcgtaaacacaaaatcgcttgcatacattgagggattctttcatgttgtt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2937860 |
tggttgcaaaaattctttatgtttcttgtatggcgtaaacacaaaatcgcttgcatacattgagggattctttcatattgtt |
2937779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University