View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12595_low_29 (Length: 369)
Name: NF12595_low_29
Description: NF12595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12595_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 22 - 364
Target Start/End: Original strand, 8659720 - 8660062
Alignment:
| Q |
22 |
gtggcttcaaccaatgacgtgtccttcctcttcttcatcttgtttcgttagtggctctagtcgctgctccctctcctctgtaaactactttgccccaaaa |
121 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8659720 |
gtggcttcaaccagtgacgtgtccttcctcttcttcatcttgtttcgttagtggctctagtcgctgctccctctcatctgtaaactactttgccccaaaa |
8659819 |
T |
|
| Q |
122 |
cccagaaaacatcatctcatctgcaatgcttcatggcaagagcttgctggagtcttactattctcagcgattcctttcactgctgtcaaagttatagcta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8659820 |
cccagaaaacatcatctcatctgcaatgcttcatggcaagagcttgctggagtcttactattctcagcgattcctttcactgctgtcaaagttatagcta |
8659919 |
T |
|
| Q |
222 |
atagtccattaggggagtcactgcagagaaaaatggaagagactaagcaacttgctgtaaaaaactcctctaaattcaaggctcaagctgccaaggccag |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8659920 |
atagtccattaggggagtcactgcagagaaaaatggaagagactaagcaacttgctgtaaaaaactcctctaaattcaaggctcaagctgccaaggccag |
8660019 |
T |
|
| Q |
322 |
aaaacagaggtagtgaccgatttcaatcattctctctgctgct |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8660020 |
aaaacagaggtagtgaccgatttcaatcattctcattgctgct |
8660062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University