View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12595_low_35 (Length: 336)
Name: NF12595_low_35
Description: NF12595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12595_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 17 - 321
Target Start/End: Original strand, 56326708 - 56327012
Alignment:
| Q |
17 |
aatttgaaggtcggagaaacaaataactactatactatgttttcctccaacaagatacattcctttagattctgtcagtttccaactctaaaacactact |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56326708 |
aatttgaaggtcagagaaacaaataactactatactatgttttcctccaacaagatacattcctttagattctgtcagtttccaactctaaaacactact |
56326807 |
T |
|
| Q |
117 |
aaaagtccaaaaccaaaacttaccagataaatagttcttccttgaaattcaaactgagttctgattgcatctcttgtgagaccagcttcgggacccacaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56326808 |
aaaagtccaaaaccaaaacttaccagataaatagttcttccttgaaattcaaactgagttctgattgcatctcttgtgagaccagcttcgggacccacaa |
56326907 |
T |
|
| Q |
217 |
gaacacgatcttcttgcaacaatgtatttagcaaggttgatttaccaacattggggcgtcctacaattgctagctgcaatggcagcttgctttcgtcagc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56326908 |
gaacacgatcttcttgcaacaatgtattcagcaaggttgatttaccaacattggggcgtcctacaattgctagctgcaatggcagcttgctttcgtcagc |
56327007 |
T |
|
| Q |
317 |
ctcag |
321 |
Q |
| |
|
||||| |
|
|
| T |
56327008 |
ctcag |
56327012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University