View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12595_low_36 (Length: 335)
Name: NF12595_low_36
Description: NF12595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12595_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 126 - 328
Target Start/End: Complemental strand, 48250909 - 48250706
Alignment:
| Q |
126 |
cgaggaggaagataaggcaaagcagagcagcgagtaacgttggtggttgtcaatagccgatgaggaactaacactgtgcctgcacttgctgcaaccgcca |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48250909 |
cgaggaggaagataaggcaaagcagagcagcgagtaacgttggtggttgtcaatagccgatgaggaactaacactgtgcctgcacttgctgcaaccgcca |
48250810 |
T |
|
| Q |
226 |
ttgtctctcacttttcttcactgttatcctt-ttttcctatgttaagaattaagattcaatgtttttgtttgtttgaggaaaatagagaaaccacccttt |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48250809 |
ttgtctctcacttttcttcactgttatcctttttttcctatgttaagaattaagattcaatgtttttgtttgtttgaggaaaatagagaaaccacccttt |
48250710 |
T |
|
| Q |
325 |
gctt |
328 |
Q |
| |
|
|||| |
|
|
| T |
48250709 |
gctt |
48250706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University