View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12595_low_39 (Length: 324)
Name: NF12595_low_39
Description: NF12595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12595_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 319
Target Start/End: Original strand, 50947299 - 50947617
Alignment:
| Q |
1 |
atttccttggttttgattcctatttaaatttaattttaaaactaccaaaaaatatgtagaaaggtatactctcgtgaactttatgcggtttgtaacaaga |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50947299 |
atttccttggttttggttcctatttaaatttaattt--aaactaccaaaaaatatgtagaaaggtatactctcgtgaactttatgcggtttgtaacaaga |
50947396 |
T |
|
| Q |
101 |
aactttatgctgttgttgaaaactctatatatggagtaatgaatttgtttggttgtggttgtacaatgcatgcttgattgatggagaccccttcttattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50947397 |
aactttatgctgttgttgaaaactctatatatggagtaatgaatttgtttggttgtggttgtacaatgcatgcttgattgatggagaccccttcttattg |
50947496 |
T |
|
| Q |
201 |
ttattacgtgtcatgatcatgaagcaagcatgtataaacatgatgtagtatgtagtagtagtcggcgggttatctatctatcttatcgcattcttacctt |
300 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50947497 |
ttatcacgtgtcatgatcatgaagcaagcatgtataaacatgatgtagtatgtagtagtagtcggcgggttatctatctatcttatcgcattcttaccta |
50947596 |
T |
|
| Q |
301 |
ggtt--cccgttcttctctct |
319 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
50947597 |
ggttcccccgttcttctctct |
50947617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University