View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12595_low_44 (Length: 285)
Name: NF12595_low_44
Description: NF12595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12595_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 54 - 152
Target Start/End: Original strand, 24360164 - 24360262
Alignment:
| Q |
54 |
gttgtggggtttgcttacaaattagggaagagtagtgagagagaaacagaaagaggagttggttggttgatgagtctagttgaaaaagaaaacggtttg |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24360164 |
gttgtggggtttgcttacaaattagggaagagtagtgagagagaaacagaaagaggagttggttggttgatgagtctagttgaaaaagaaaacggtttg |
24360262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 24360300 - 24360347
Alignment:
| Q |
186 |
aatatttagatgtgtgtgtgtcttcttgtctttgactccatggccttg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24360300 |
aatatttagatgtgtgtgtgtcttcttgtctttgactccatggccttg |
24360347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University