View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12595_low_53 (Length: 253)
Name: NF12595_low_53
Description: NF12595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12595_low_53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-125; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 16240212 - 16239975
Alignment:
| Q |
1 |
tagtaacgacaatgtgaatcaccacttattgtaagctttctacaataacctttacaatccatcgtagaacaactacccacaatttttgcacatgtagctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16240212 |
tagtaacgacaatgtgaatcaccacttattgtaagctttctacaataacctttacaatccatcgtagcacaactacccacaatttttgcacatgtagctc |
16240113 |
T |
|
| Q |
101 |
ccaccagtattgattgcactgtgctcccaatcaaattggggaagaaatattagtgagttttcgatccaacaaccacggatatgctaatcggatctagcaa |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16240112 |
ccaccagtattgattgcactgtactcccaatcaaattggggaagaaatattagtgagttttcgatccaacaaccacggatatgctaatcggatctagcaa |
16240013 |
T |
|
| Q |
201 |
gaccaggattgcttgcagtcaaaagtttgccaattcat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16240012 |
gaccaggattgcttgcagtcaaaagtttgccgattcat |
16239975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 16264805 - 16264727
Alignment:
| Q |
51 |
tttacaatccatcgtagaacaactacccacaatttttgcacatgtagctcccaccagtattgattgcactgtgctccca |
129 |
Q |
| |
|
||||||||||||| |||||| ||||| |||||| ||| ||||||||| | || ||||||||||||||| | |||||| |
|
|
| T |
16264805 |
tttacaatccatcacagaacagctaccaacaattcttgggcatgtagcttctactagtattgattgcactatactccca |
16264727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University