View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12595_low_61 (Length: 240)

Name: NF12595_low_61
Description: NF12595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12595_low_61
NF12595_low_61
[»] chr2 (2 HSPs)
chr2 (1-224)||(16240241-16240464)
chr2 (26-84)||(16267743-16267801)


Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 16240241 - 16240464
Alignment:
1 tcactaccccctaaaattcaaggaataccaatgtgcagtctagggtatggactttgcgacgctaattgtgattcaaactgttgcgatgcaaagtgtactt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16240241 tcactaccccctaaaattcaaggaataccaatgtgcagtctagggtatggactttgcgacgctaattgtgattcaaactgttgcgatgcaaagtgtactt 16240340  T
101 ccgcagaaagagtctacaaaaatccttatgggaaatgtactaatatggccaacaaaaactattgtatttgttactatgatcacccttgaattgctcccaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
16240341 ccgcagaaagagtctacaaaaatccttatgggaaatgtactaatatggctaacaaaaactattgtatttgttactatgatcacccttgaattgctcccaa 16240440  T
201 tccttataaattgaaataatacgt 224  Q
    ||||||||||||||||||||||||    
16240441 tccttataaattgaaataatacgt 16240464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 16267743 - 16267801
Alignment:
26 taccaatgtgcagtctagggtatggactttgcgacgctaattgtgattcaaactgttgc 84  Q
    |||||| ||||||| | ||||||||| ||||||| | | ||||||||||||||||||||    
16267743 taccaaggtgcagttttgggtatggaatttgcgaagatgattgtgattcaaactgttgc 16267801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University