View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12595_low_62 (Length: 234)
Name: NF12595_low_62
Description: NF12595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12595_low_62 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 785696 - 785929
Alignment:
| Q |
1 |
agtaaagctttgtaaggactaataatccaacacaaaaattgttagtattttgatgattcgaatgagtcctaga-----aggagcacatgcacatcttaaa |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
785696 |
agtaaagctttgtaaggactaataatccaacacaaaaattgttagtattttgatgattcgaatgagtcctagagtagaaggagcacatgcacatcttaaa |
785795 |
T |
|
| Q |
96 |
tcccaacgtatatcaccgaaacaacccttagggttggaataataccgttgcattttagtgttaagttttaactcatttgaactcaaaatctcttgttaag |
195 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
785796 |
tcccaacgtatatcaccgagacaacccttagggttggaataatacagttgcattttagtgttaagtttgaactcatttgaactcaaaatctcttgttaaa |
785895 |
T |
|
| Q |
196 |
tgggaagaaatctaattctaaaccatttcattgt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
785896 |
tgggaagaaatctaattctaaaccatttcattgt |
785929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University