View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12595_low_64 (Length: 226)
Name: NF12595_low_64
Description: NF12595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12595_low_64 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 205
Target Start/End: Complemental strand, 45253149 - 45252962
Alignment:
| Q |
18 |
gaaatggaaagtgggccatggaagttggagttgaagagagcggtggtgatattttgagcgatggaattagcgtcgttgaagtatcgtgggacttgacagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45253149 |
gaaatggaaagtgggccatggaagttggagttgaagagagcggtggtgatattttgagcgatggaattagcgtcgttgaagtatcgtgggacttgacagt |
45253050 |
T |
 |
| Q |
118 |
tttctatgtcccaccaaacggatatcttcgccgacgagaatgtactaccatcttccatcatctaactaacccattcattacctcactt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45253049 |
tttctatgtcccaccaaacggatatcttcgccgacgagaatgtactaccatcttccatcatctaactaacccattcattacctcactt |
45252962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University