View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12595_low_67 (Length: 219)
Name: NF12595_low_67
Description: NF12595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12595_low_67 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 8660030 - 8660234
Alignment:
| Q |
1 |
tagtgaccgatttcaatcattctcattgctgctgcatcaatgaattgtgctcattcattccttaaactttttcagcttttggtacggacaaggtcggcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8660030 |
tagtgaccgatttcaatcattctcattgctgctgcatcaatgaattgtgctcattcattccttaaactttttcagcttttggtacggacaaggtcggcct |
8660129 |
T |
|
| Q |
101 |
cgttggcttggtcctatctcgtatgacggctacccatcatatctccatggggaactgcctggggattacggctttgacattgctggccttgccaaggatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8660130 |
cgttggcttggtcctatctcgtatgacggctacccatcatatctccatggggaactgcctggggattacggctttgacattgctggccttgccaaggatc |
8660229 |
T |
|
| Q |
201 |
cagtg |
205 |
Q |
| |
|
||||| |
|
|
| T |
8660230 |
cagtg |
8660234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University