View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12595_low_68 (Length: 217)
Name: NF12595_low_68
Description: NF12595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12595_low_68 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 8038292 - 8038106
Alignment:
| Q |
18 |
aaacacaacgtaaccaaaacttatccagccaagaaaaaagaaaatatgtggaacaa-ggcttagaaagcctttggcttaagaatatgttgcaactgagat |
116 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8038292 |
aaacacaatgtaactaaaacttatccagccaagaaaaaagaaaatatgtggaacaaaggcttaaaaagcctttggcttaagaatatgttgcaactgagat |
8038193 |
T |
|
| Q |
117 |
ttctgacttttcactctttcttccaaaggaataactttcgaattaggttttggaataactcttggccattctatgcaccctttcatc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8038192 |
ttctgacttttcactctttcttccaaaggaataactttcaaattaggttttggaataactcttggccattctatgcatcctttcatc |
8038106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University