View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12596_high_13 (Length: 217)
Name: NF12596_high_13
Description: NF12596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12596_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 61 - 175
Target Start/End: Complemental strand, 49394437 - 49394323
Alignment:
| Q |
61 |
aatcgtatccacaacgacctgatgaagctgattgtatctattatttgaggacaggtttttgcggttatggttctaggtgtcggtttaaccatccacgtga |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49394437 |
aatcgtatccacaacgacctgatgaagctgattgtatctattatttgaggacaggtttttgcggttatggttctaggtgtcggtttaaccatccacgtga |
49394338 |
T |
|
| Q |
161 |
ccgaggcgcggtaaa |
175 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
49394337 |
ccgtggcgcggtaaa |
49394323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 66 - 174
Target Start/End: Original strand, 6500514 - 6500622
Alignment:
| Q |
66 |
tatccacaacgacctgatgaagctgattgtatctattatttgaggacaggtttttgcggttatggttctaggtgtcggtttaaccatccacgtgaccgag |
165 |
Q |
| |
|
|||||||||||||||||||| | |||||||| || |||||||| || |||||||| || | |||||||||||||||||| || ||||| |||||||| | |
|
|
| T |
6500514 |
tatccacaacgacctgatgaggttgattgtacttactatttgagaactggtttttgtggctttggttctaggtgtcggttcaatcatccccgtgaccgtg |
6500613 |
T |
|
| Q |
166 |
gcgcggtaa |
174 |
Q |
| |
|
|||||||| |
|
|
| T |
6500614 |
ccgcggtaa |
6500622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University