View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12596_high_6 (Length: 317)
Name: NF12596_high_6
Description: NF12596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12596_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 187 - 316
Target Start/End: Original strand, 11094836 - 11094965
Alignment:
| Q |
187 |
ttataatttttggtatgcatgattaagataatataacaatattcaacgattgtatcaatgaaatttagtgtctaccaagagatattaagtgaagtaacta |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11094836 |
ttataatttttggtatgcatgattaagataatataacaatattcaacaattgtatcaatgaaatttagtgtctaccaagagatattaagtgaagtaacta |
11094935 |
T |
 |
| Q |
287 |
acaaaacttagcaagttgatctccaccctt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11094936 |
acaaaacttagcaagttgatctccaccctt |
11094965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 67
Target Start/End: Original strand, 11094223 - 11094267
Alignment:
| Q |
23 |
ttacctttatgccttgcaaataaagccaaagaatcacatgaataa |
67 |
Q |
| |
|
||||||||||||||||||||| ||||||| | ||||||||||||| |
|
|
| T |
11094223 |
ttacctttatgccttgcaaatgaagccaatggatcacatgaataa |
11094267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University