View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12596_low_11 (Length: 346)
Name: NF12596_low_11
Description: NF12596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12596_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 19 - 324
Target Start/End: Original strand, 5320500 - 5320805
Alignment:
| Q |
19 |
ttgtttaacatgaattgcgattctattatgatctttatcccaacagaaagaaggaataaggtttatttgatatgattttgctagctaatcaaaaagcata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5320500 |
ttgtttaacatgaattgcgattctattatgatctttatcccaacagaaagaaggaataaggtttatttgatatgattttgctagctaatcaaaaagcata |
5320599 |
T |
|
| Q |
119 |
tcactttttaggatgctcctacatgtagtgtctttgtgtcatgcacttctttaagtagtaggaatgtaaagcacagtctcttacaatttactacccattc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5320600 |
tcactttttaggatgctcctacatgtagtgtctttgtgtcatgcacttctttaagtagtaggaatgtacagcacagtctcttacaatttactacccattc |
5320699 |
T |
|
| Q |
219 |
acataatttggatcctttatgcccagggctgtcctaatgtctgaatcagtagagtaagggccttataccacccttttacttaatattcttaactgtgttt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5320700 |
acataatttggatcctttatgcccagggctgtcctaatgtctgaatcagtagggtaagggccttataccacccttttacttaatattcttaactgtgttt |
5320799 |
T |
|
| Q |
319 |
tctcct |
324 |
Q |
| |
|
|||||| |
|
|
| T |
5320800 |
tctcct |
5320805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University