View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12596_low_16 (Length: 289)
Name: NF12596_low_16
Description: NF12596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12596_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 11 - 270
Target Start/End: Complemental strand, 37029639 - 37029380
Alignment:
| Q |
11 |
cacagacaaccatgtagtacacggataaacgacaaggtcggcgaagatcatcgcatactaatgataaggtcaaagtgttgcaccagagtcttattacttg |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37029639 |
cacaggcaaccatgtagtacacggataaacgacaaggtcggcgaagatcatcgcatactaatgataaggtcaaagtgttgcaccagagtcttattacttg |
37029540 |
T |
|
| Q |
111 |
attcattaataactataatacagaccttcaattcaactggaaacagtatatgtcatcattgttacagctgggggaatctcatcaaaatatctcccctttc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37029539 |
attcattaataactataatacagaccttcaaatcaactggaaacagtatatgtcatcattgttacagctgggggaatctcatcaaaatatctcccctttc |
37029440 |
T |
|
| Q |
211 |
aactatataactgaaagaaagacgaactaaacacccatttgactactcttgtgtccccca |
270 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
37029439 |
aactatataactgaaagaaagacgatctaaacacccatttgactagtcttgtgtccccca |
37029380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University