View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12596_low_22 (Length: 218)
Name: NF12596_low_22
Description: NF12596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12596_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 20 - 200
Target Start/End: Original strand, 42341052 - 42341232
Alignment:
| Q |
20 |
tggaatgcagaagaaaaccaacaacaagctgcatccaacaataataacagcaacaacaataacttgtctgcagctcagaaagggattagcaaacaggcaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42341052 |
tggaatgcagaagaaaaccaacaacaagctgcatccaacaataataacagcaacaacaataacttgtctgcagctcagaaagggattagcaaacaggcaa |
42341151 |
T |
|
| Q |
120 |
gtcttcctcgccaaaattcgttatcgattcctgctcctctctgcaggaaaactgtggaacaagtttggtctgagatacaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42341152 |
gtcttcctcgccaaaattcgttatcgattcctgctcctctctgcaggaaaactgtggaacaagtttggtctgagatacaca |
42341232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University