View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12596_low_24 (Length: 210)
Name: NF12596_low_24
Description: NF12596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12596_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 50865058 - 50865254
Alignment:
| Q |
1 |
gaagccatgggagcagcattcgagcgtaatcagacttcctcggtttgactacaatgctccgtcttctcttctcactcattctcattccgcctttcttatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50865058 |
gaagccatgggagcagcattcgagcgtaatcagacttcctcggtttgactacaatgctccgtcttctcttctcactcattctcattccgcctttcttatc |
50865157 |
T |
 |
| Q |
101 |
acttgtacaatcagtgagtcaataata-----tcttctcttctcttcctttattcttcaaattcaatcgcttattatgttaattgaccctagctaatt |
193 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50865158 |
acttgtacaatcagtgagtcaataatatcttctcttctcttctcttcctttattcttcaaattcaatcgcttattatgttaattga-cctagctaatt |
50865254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University