View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12596_low_9 (Length: 376)
Name: NF12596_low_9
Description: NF12596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12596_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 20 - 349
Target Start/End: Complemental strand, 30239964 - 30239633
Alignment:
| Q |
20 |
tctatatcatagtagaaaacactcataggggttatgatcaccaccctacctgtaatccactgcgaattgggtgaatggggtttggaccacaaggttccat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30239964 |
tctatatcatagtagaaaacactcataggggttatgatcaccaccctacctgtaatccactgcgaattgggtgaatggggtttggaccacaaggttccat |
30239865 |
T |
|
| Q |
120 |
ccatcc--acaccaaaatgtcacaaactcatacctattggctccaatatttgaataataactactcttctggttcattctcttcacaagctccatttatt |
217 |
Q |
| |
|
||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30239864 |
ccacaccaaaaccaaaatgtcacaaactcatacctattggctccaatatttgaataataactactcttctggttcattctcttcacaggctccatttatt |
30239765 |
T |
|
| Q |
218 |
tctacactgcatttaatattctgctcaaatggtccatattgtgggatttttagtgctcatggaagtgctctgattctgaccannnnnnnaaccaagtcca |
317 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30239764 |
tctacattgcatttaatattctgctcaaatggtccatattgtgggatttttagtgctcatggaagtgctctgattctgaccatttttttaaccaagtcca |
30239665 |
T |
|
| Q |
318 |
aacaaaatgaaacattttcatcggtcagatta |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30239664 |
aacaaaatgaaacattttcatcggtcagatta |
30239633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University