View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12597_high_10 (Length: 351)
Name: NF12597_high_10
Description: NF12597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12597_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 114 - 237
Target Start/End: Complemental strand, 40368988 - 40368868
Alignment:
| Q |
114 |
ttagataactcataacaccaatttgatcataaattaagaggaaaatcatatggtctagttattaaatttcttatctatttaaagttttgaaaaatttaca |
213 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40368988 |
ttagataactcataacaccaatttgat---aaattaagaggaaaatcatatggtctagtttttaaatttcttatctatttaaagttttgaaaaatttaca |
40368892 |
T |
 |
| Q |
214 |
ataatatttgtaagtttagtggat |
237 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40368891 |
ataatatttgtaagtttagtggat |
40368868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 17 - 84
Target Start/End: Complemental strand, 40369053 - 40368986
Alignment:
| Q |
17 |
atttgaatgttgattctcccaaaagataaattttatgagattcggacgcttgattgatcacatgttta |
84 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40369053 |
atttgaatgttgattctcccaagagataaattttatgagattcggacgcttgattgatcacatgttta |
40368986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University