View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12597_high_23 (Length: 291)
Name: NF12597_high_23
Description: NF12597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12597_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 33108576 - 33108857
Alignment:
| Q |
1 |
ccaccatgaatcaactttgctctttaacttttcccagaaaactacaatataattttggtttctagtcaccaataacgccgtagattgtaagtaaacggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33108576 |
ccaccatgaatcaactttgctctttaacttttcccagaaaactacaatataattttggtttctagtcaccaataacgccgtagattgtaagtaaacggaa |
33108675 |
T |
 |
| Q |
101 |
gctgcacgcttaaccaattcgttcttgatagcaatgtccgagtcaaaaacatttccttcatacaatgaacatcttgttgatgtattgcacataatgtcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33108676 |
gctgcacgcttaaccaattcgttcttgatagcaatgtccgagtcaaaaacatttccttcatacaatgaacatcttgttgatgtattgcacataatgtcct |
33108775 |
T |
 |
| Q |
201 |
ttaaacttatgtaatgtaagttgtcattgatatctgaatgtcttctttctattgaggatttgtttggaattctcagtgaacg |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
33108776 |
ttaaacttatgtaatgtaagttgtcattgatatctgaatgtcttctttctattgaggatttgtttggaattcttaatgaacg |
33108857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University