View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12597_high_32 (Length: 244)
Name: NF12597_high_32
Description: NF12597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12597_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 5320503 - 5320262
Alignment:
| Q |
1 |
acaatgattgttgtatttgcaataaaacagtgataacaccatcattaacattctcaatattagacaaatagccagaatttagtacagaattagaattaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5320503 |
acaatgattgttgtatttgcaataaaacagtgataacaccatcattaacattctcaatattagacaaatagccagaatttagtacagaattagaattaac |
5320404 |
T |
 |
| Q |
101 |
aaagctaaattctccatcatttttccatcttagccgcagctatatcttttattttgggagatttgttttccttgttctctcactactctatcgacaaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5320403 |
aaagctaaattctccatcatttttccatcttagccgcagctatatcttttattttgggagatttgttttccttgttctctcactactctatcgacaaaat |
5320304 |
T |
 |
| Q |
201 |
gattattatgtacaaaacattctagaaagctgtcttcatctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5320303 |
gattattatgtacaaaacattctagaaagctgtcttcatctc |
5320262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University