View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12597_low_10 (Length: 406)
Name: NF12597_low_10
Description: NF12597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12597_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 165 - 400
Target Start/End: Original strand, 39305608 - 39305840
Alignment:
| Q |
165 |
gttcatattgtttgggtgcacttcattttattatgagctacactaaatgtttgttcgtagatattattattctacgcaggtatacatagaaaatatggta |
264 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39305608 |
gttcatattgtttgggtgcaattcattttattatgagctacactaaatgtttgttcgtagatatt---attctacgcaggtatacatagaaaatatggta |
39305704 |
T |
 |
| Q |
265 |
acaacaaaggtagcaattattatatatctgaaatgcaatcttaatcagaaccaaactccccagtaactagaagcttgagttggaattaatccacgagacg |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39305705 |
acaacaaaggtagcaattattatatatctgaaatgcaatcttaatcagaaacaaactccccagtaactagaagcttgagttggaattaatccacgagacg |
39305804 |
T |
 |
| Q |
365 |
aaatctggaagagtgttgggatcagccctatgcttc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39305805 |
aaatctggaagagtgttgggatcagccctatgcttc |
39305840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 21 - 102
Target Start/End: Original strand, 39305464 - 39305545
Alignment:
| Q |
21 |
tagatattctctaatagaattgatttagccattttaacttcttttgtgagagaaaaaataattctaacttgtccctcgagtg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39305464 |
tagatattctctaatagaattgatttagccattttaacttcttttgtgagagaaaaaataattctaacttgtccctcgagtg |
39305545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University