View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12597_low_22 (Length: 327)
Name: NF12597_low_22
Description: NF12597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12597_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 52; Significance: 8e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 260 - 315
Target Start/End: Complemental strand, 19127358 - 19127303
Alignment:
| Q |
260 |
ccactgtctcttagatggtttgttggtacgtgtatttccaagaattccccagtgaa |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19127358 |
ccactgtctcttagatggtttgttggtacgtgtatttccaagaattccctagtgaa |
19127303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 19127505 - 19127454
Alignment:
| Q |
18 |
gataatacagataaagataaagcagaagaaaagggattgatggatggaagag |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19127505 |
gataatacagataaagataaagcagaagaaaagggattgatagatggaagag |
19127454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 264 - 308
Target Start/End: Original strand, 14961588 - 14961632
Alignment:
| Q |
264 |
tgtctcttagatggtttgttggtacgtgtatttccaagaattccc |
308 |
Q |
| |
|
|||||||||||||||||| |||| | ||||||||||||||||||| |
|
|
| T |
14961588 |
tgtctcttagatggtttgctggtgcatgtatttccaagaattccc |
14961632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University