View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12597_low_24 (Length: 311)
Name: NF12597_low_24
Description: NF12597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12597_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 279; Significance: 1e-156; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 17 - 295
Target Start/End: Complemental strand, 36999090 - 36998812
Alignment:
| Q |
17 |
atagtatacttttgaagaactcttttttcttctttcaatgtgctagttatgggtcacatttgtgttgtttgttcctaacatgtgttgaactaatttatct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36999090 |
atagtatacttttgaagaactcttttttcttctttcaatgtgctagttatgggtcacatttgtgttgtttgttcctaacatgtgttgaactaatttatct |
36998991 |
T |
|
| Q |
117 |
ccagactgagaagatgacagcacgtgatcctgtgcaaaaagagatggcaacccataagaaagaggcaaagatgaaccaggcagagctagataagctggca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36998990 |
ccagactgagaagatgacagcacgtgatcctgtgcaaaaagagatggcaacccataagaaagaggcaaagatgaaccaggcagagctagataagctggca |
36998891 |
T |
|
| Q |
217 |
gcacgtgaacacaatgcggcggtcaaacagacgaccactgctgcggctgggcatatgggtcagccccaccacaccacag |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36998890 |
gcacgtgaacacaatgcggcggtcaaacagacgaccactgctgcggctgggcatatgggtcagccccaccacaccacag |
36998812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 118 - 230
Target Start/End: Complemental strand, 36994182 - 36994070
Alignment:
| Q |
118 |
cagactgagaagatgacagcacgtgatcctgtgcaaaaagagatggcaacccataagaaagaggcaaagatgaaccaggcagagctagataagctggcag |
217 |
Q |
| |
|
||||| ||||||||||| |||| ||||||| |||||||||||||||||||||| |||||||| | || | | |||||||| ||||| ||||| ||| | |
|
|
| T |
36994182 |
cagacagagaagatgacggcacatgatcctttgcaaaaagagatggcaacccaaaagaaagaagaaagggttaaccaggctgagcttgataaagaggcgg |
36994083 |
T |
|
| Q |
218 |
cacgtgaacacaa |
230 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
36994082 |
cgcgtgaacacaa |
36994070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 118 - 179
Target Start/End: Complemental strand, 36988407 - 36988346
Alignment:
| Q |
118 |
cagactgagaagatgacagcacgtgatcctgtgcaaaaagagatggcaacccataagaaaga |
179 |
Q |
| |
|
||||| ||||||||||| |||| ||||||| ||||||| |||||||||||||| |||||||| |
|
|
| T |
36988407 |
cagacagagaagatgacggcacatgatcctttgcaaaaggagatggcaacccaaaagaaaga |
36988346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University