View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12597_low_27 (Length: 294)
Name: NF12597_low_27
Description: NF12597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12597_low_27 |
 |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0102 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 17 - 287
Target Start/End: Complemental strand, 34778 - 34508
Alignment:
| Q |
17 |
tcagggtgaactagacacctagcagccagttgtagattcacagcagtcgccttggcttgaccaattcccaattgattgataattgatttaggcatcaaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34778 |
tcagggtgaactagacacctagcagccagttgtaaattcacagcagtaggcttggcttgaccaattcccaattgattgataattgatttaggcatcaaat |
34679 |
T |
 |
| Q |
117 |
tgatgctttcccctaaatcacaaagtgcctccccacaataaactccacctatagaacatggaatagtgaagctaaatgggtccttcatctttcctggtat |
216 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34678 |
tgatgcttgcccctaaatcacaaagtgcctccccacaataaactccacctatagaacatggaatagtgaagctacatgggtccttcatctttcctggtat |
34579 |
T |
 |
| Q |
217 |
cttgtgttggatcaacatgctgctttcagctgtcattgctaacgtcttaaagtctcccaaccttcttctct |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
34578 |
cttgtgttggatcaacatgctgctttcagctgtcattgctaatgtcttaaagtcgcccaaccttcttctct |
34508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 21 - 190
Target Start/End: Complemental strand, 13840853 - 13840684
Alignment:
| Q |
21 |
ggtgaactagacacctagcagccagttgtagattcacagcagtcgccttggcttgaccaattcccaattgattgataattgatttaggcatcaaattgat |
120 |
Q |
| |
|
||||||| ||| ||||| || | |||| ||||||| ||||| | | ||||||||||||||||||||||||||||| |||| |||||||||| | |||||| |
|
|
| T |
13840853 |
ggtgaacaagagacctatcaacaagttttagattcgcagcactaggcttggcttgaccaattcccaattgattgaaaatttatttaggcattagattgat |
13840754 |
T |
 |
| Q |
121 |
gctttcccctaaatcacaaagtgcctccccacaataaactccacctatagaacatggaatagtgaagcta |
190 |
Q |
| |
|
|||| | || ||||||||||| |||| ||||||||||||| || ||||| || | ||||| ||||||||| |
|
|
| T |
13840753 |
gcttgctccaaaatcacaaagcgccttcccacaataaacttcatctataaaataaggaatggtgaagcta |
13840684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University