View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12597_low_29 (Length: 276)
Name: NF12597_low_29
Description: NF12597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12597_low_29 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 21 - 276
Target Start/End: Original strand, 36840607 - 36840864
Alignment:
| Q |
21 |
ctattagataggaacagatttgattcaagtttgatacgaannnnnnnnncttt--caaaactattagattataaatcgaaagagtattttcttgtaaaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36840607 |
ctattagataggaacagatttgattcaagtttgatacgaaaaaacaattttttttcaaaactattagattataaaccgaaagagtattttcttgtaaaaa |
36840706 |
T |
 |
| Q |
119 |
taggtaatatcttccattcttgttgtttacagcaccgaacagggtgtttagtcggatgctatagaaaactgcaaaaatggtgcttgtcgtctgtttttga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36840707 |
taggtaatatcttccattcttgttgtttacagcaccgaacaggctgtttagtcggatgctatagaaaactgcaaaaatggtgcttgtcgtctgtttttga |
36840806 |
T |
 |
| Q |
219 |
cgagtaccagcgctttgcagcagcaaaagctcgagtttcagatcagaggtttgtagag |
276 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36840807 |
cgagtaccagcgctttgcagcagcgaaagctcgagtttcagatcagaggtttgtagag |
36840864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University