View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12597_low_31 (Length: 273)
Name: NF12597_low_31
Description: NF12597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12597_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 4 - 256
Target Start/End: Complemental strand, 36841192 - 36840940
Alignment:
| Q |
4 |
ggaggagcagagaaaaacacaaaaataaagagaaagtaaaatagtttgaagagacagatacatcttaatactatatactacttgatgaattttcttatct |
103 |
Q |
| |
|
|||| |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36841192 |
ggagcagcaaagaaaaacacaaaagtaaagagaaagtaaaatagtttgaagagacagatacatcttaatactatatactacttgatgaattttcttatct |
36841093 |
T |
 |
| Q |
104 |
tatttctaaaaaatgggagaagaatatttttactcctttgttgctgcaatgccttgaaggagttcatcaccttttcctattttattattcaaaaggtaga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36841092 |
tatttctaaaaaatgggagaagaatatttttactcctttgttgctgcaatgccttgaaggagttcatcaccttttcctattttattattcaaaaggtaga |
36840993 |
T |
 |
| Q |
204 |
accttggattcactttcacaagctaaagaaaggaaaacccaatttagcataac |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36840992 |
accttggattcactttcacaagctaaagaaaggaaaacccaatttagcataac |
36840940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University