View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12597_low_35 (Length: 264)
Name: NF12597_low_35
Description: NF12597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12597_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 258
Target Start/End: Complemental strand, 52071195 - 52070954
Alignment:
| Q |
17 |
aaaaaggactatccacagatttgctagttgattttaacatgggagatcatgatattagcttatccgaacttttgaactcggatttttcaactgcatgcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52071195 |
aaaaaggactatccacagatttgctagttgattttaacatgggagatcatgatattagcttatccgaacttttgaactcggatttttcaactgcatgcaa |
52071096 |
T |
|
| Q |
117 |
ttttgattacaatgagttattgtcaccttgttctgaccagactcctatgttttcggatgagattctcaagaactggacagaatgtagctttgttgatgag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52071095 |
ttttgattacaatgagttattgtcaccttgttctgaccagactcctatgttttcggatgagattctcaagaactggacagaatgtagttttgttgatgag |
52070996 |
T |
|
| Q |
217 |
aaaaatgtgactaacaaccttcattatttcacttcttctctc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
52070995 |
aaaaatgtgactaacaaccttcattattttacttcttttctc |
52070954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University