View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12597_low_41 (Length: 242)
Name: NF12597_low_41
Description: NF12597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12597_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 40489892 - 40489682
Alignment:
| Q |
18 |
agattcggtatattttcttattgaagtgtttattgtgagtgcaaagaatccaattttggtatattcttctatattgaacactgnnnnnnnnnnnnnnnac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40489892 |
agattcggtatattttcttattgaagtgtttattgtgagtgcaaagaatccaattttggtatattcttctatattgaacactgtttttattttt----ac |
40489797 |
T |
 |
| Q |
118 |
gtaactatcatctaaagtagtcttgaaccaaaggtgcatctccttcttccatttactttatattatttaaataaaaacggtagtcttatctcacgtggaa |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40489796 |
gtaactatcatctaaagtagtctggaaccaaaggtgcatctccttcttccatttactttatattatttaaataaaaacagtagtcttatctcacgtggaa |
40489697 |
T |
 |
| Q |
218 |
taaacgaggcctttg |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
40489696 |
taaacgaggcctttg |
40489682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University