View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12597_low_45 (Length: 228)
Name: NF12597_low_45
Description: NF12597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12597_low_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 10 - 216
Target Start/End: Complemental strand, 37071348 - 37071141
Alignment:
| Q |
10 |
ggagaagcagagagtctaagcataatgcttcttttccttgaacatatggtttttaacccgtggcaaaccaaacccaacttggatttggtttcctga-gga |
108 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37071348 |
ggagaagcagggagtctaagcataatgcttcttttccttgaacatatggtttttaacccgtggcaaaccaaacccaacttggatttggtttcctgaagga |
37071249 |
T |
|
| Q |
109 |
gaaacatacccaagactgagtaacttgttcaagaaagttaaggtcccgtcgacattgtcaagaaggaaaacaaaggaaaaccttcttcgcactgcttttg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37071248 |
gaaacatacccaagactgagtaacttgttcaagaaagttaaggtcccgtcgacattgtcaagaaggaaaacaaaggaaaaccttcttcgcactgcttttg |
37071149 |
T |
|
| Q |
209 |
atgtccat |
216 |
Q |
| |
|
||| |||| |
|
|
| T |
37071148 |
atggccat |
37071141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University