View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12597_low_49 (Length: 217)

Name: NF12597_low_49
Description: NF12597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12597_low_49
NF12597_low_49
[»] chr3 (1 HSPs)
chr3 (1-214)||(48491812-48492023)


Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 48491812 - 48492023
Alignment:
1 aataaatagggtaaattgtcccgtaaagattgggnnnnnnnnnnnnttggatacggtgaagcgaaggtgaaggcgtaaagagaaaccgaaaaggtgaagt 100  Q
    |||||||||||||||| |||||||||||||||||             |||||||||||||||||||||||||||||||||||||| ||||||||||||||    
48491812 aataaatagggtaaatcgtcccgtaaagattgggaaaaaacaaaaaatggatacggtgaagcgaaggtgaaggcgtaaagagaaatcgaaaaggtgaagt 48491911  T
101 aaccgataaagatggtgacgtgtcgaaaaggatataaatatcgtgcagtttcgtcattcatgnnnnnnngactcatagttgtacccgttagagcgggaac 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |       |||||||||||||||||||||||||||||||    
48491912 aaccgataaagatggtgacgtgtcgaaaaggatataaatatcgtgcagtttcgtcattcaag--tttttgactcatagttgtacccgttagagcgggaac 48492009  T
201 cccccaaatttcat 214  Q
    ||||||||||||||    
48492010 cccccaaatttcat 48492023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University